cDNA Clone SGK3

• Synonyms: CISK, SGKL, SGK2
• Plasmid: pX355 SGK3 common sense B
• Parent Plasmid: pX355
• Expressed: SGK3 common sense B
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GTCAGATCCATCTGAAGATG(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48667
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in first common exon (exon 6), to be co-transfected with 48668 and positives enriched for with Puromycin prior to screening. Western blotting should be preferentially used to screen for KOs as there is a good antibody, alternatively indel formation may lead to the loss of a PsuI site allowing RFLP screening. Guide sequence shown as sequence of insert with PAM in brackets. Note this system does not require a Trex cell-line nor induction with Tet/Dox.