cDNA Clone SGK3

• Synonyms: CISK, SGKL, SGK2
• Plasmid: pLVX TRE3GS H U6 SGK3 common antisense
• Parent Plasmid: pLVX TRE3GS
• Expressed: SGK3 common antisense
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GATGGATCTGACTGGTGTTT(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48730
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Lentiviral vector for use in CRISPR procedures. Targets antisense strand in first common exon (exon 6), to be used to infect target cells followed by Hygromycin selection. Positive cells should be subsequently infected with virus derived from 48747 follwed by induction with Dox to express Cas9 D10A. Western blotting should be preferentially used to screen for KOs as there is a good antibody. Guide sequence shown as sequence of insert.