cDNA Clone WNK3

• Synonyms: PRKWNK3
• Plasmid: pBABED P WNK3 KO ex2 sense
• Parent Plasmid: pBABED P U6
• Expressed: WNK3 KO ex2 sense
• Genbank: NM_020922.4
• Species: Human

Sequence of Insert

GTTTGACATAGAACTAGGAAG

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48773
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in first common coding exon (exon 2), designed to KO WNK3 when used in conjunction with antisense guide 48799 (D10A approach). Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection using western blotting.