cDNA Clone WNK1

• Synonyms: HSAN2, HSN2, KDP, PPP1R167, PRKWNK1, PSK, p65
• Plasmid: pBABED P WNK1 D368A sense
• Parent Plasmid: pBABED P U6
• Expressed: WNK1 D368A sense
• Genbank: NM_018979.3
• Species: Human

Sequence of Insert

GTCGGTCTGGCAACCCTGAAG

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48774
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in exon 3, designed to introduce a D368A point mutation when used in conjunction with antisense guide 48783 and a ssODN donor (D10A approach). Guide sequence shown as sequence of insert and donor shown as expression cassette. Positives may be enriched for with puromycin prior to further selection using western blotting with a phospho specific antibody or RFLP using the SfoI site introduced upon recombination.