cDNA Clone SGK3

• Synonyms: CISK, SGKL, SGK2
• Plasmid: pBABED P U6 SGK3 Cter KI Sense
• Parent Plasmid: pBABED P U6
• Expressed: SGK3 Cter KI Sense guide
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GAGGCAGATGATGCATTCGT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48801
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand at very end of the last coding exon, may be used in conjunction with 48802 and donor 48103 to insert an in-frame GFP to the c-terminus of SGK3. Positives may be enriched for with puromycin and further screening done by FACs looking for GFP expression.