cDNA Clone SGK3

• Synonyms: CISK, SGKL, SGK2
• Plasmid: pX335 SGK3 Nter antisense
• Parent Plasmid: pX335
• Expressed: SGK3 Nter antisense guide
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GCAGCTTTCCTTGTAGTCCA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48818
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets antisense strand in first coding exon, may be used in conjunction with 48800 and donor 48167 to insert a GFP cassette knocking out SGK3. Positives may be enriched for with puromycin and further screening done by FACs looking for GFP expression and western blotting to confirm SGK3 KO.