cDNA Clone STAT3 mouse

• Synonyms: 1110034C02Rik, AW109958, Aprf
• Plasmid: pKN7 STAT3m KO sense B
• Parent Plasmid: pKN7
• Expressed: STAT3m KO sense B guide
• Genbank: NM_213659.2
• Species: Mouse

Sequence of Insert

GTGCGGCAGTTCCTGGCACCT

• Vector Type: Other
• Antibiotic: Kan
• DU Number: DU48846
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in exon 2, designed to KO STAT3m when co-transfected with antisense guide 48863. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.