cDNA Clone KLHL2

• Synonyms: ABP-KELCH, MAV, MAYVEN
• Plasmid: pKN7 KLHL2 KO sense B
• Parent Plasmid: pKN7
• Expressed: KLHL2 KO sense B guide
• Genbank: ENSG00000109466
• Species: Human

Sequence of Insert

GATGTACCGACCTTCTGAACA

• Vector Type: Mammalian
• Antibiotic: Kan
• DU Number: DU48888
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in exon 5, designed to KO KLHL2 when co-transfected with antisense guide 48896. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.