cDNA Clone KLHL2

• Synonyms: ABP-KELCH, MAV, MAYVEN
• Plasmid: pX335 KLHL2 KO antisense
• Parent Plasmid: pX335
• Expressed: KLHL2 KO antisense guide
• Genbank: ENSG00000109466
• Species: Human

Sequence of Insert

GTTATTCTAACTCTCTTTGCT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48895
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in exon 4, designed to KO KLHL2 when co-transfected with sense guide 48893. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.