cDNA Clone RAB13

• Synonyms: GIG4
• Plasmid: pX335 RAB13 S111A KI antisense
• Parent Plasmid: pX335
• Expressed: RAB13 S111A KI antisense guide + Cas9 D10A
• Genbank: NM_005370.4
• Species: Human

Sequence of Insert

GCCCCAGCCGAGGCATTCTGG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52018
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KI guide, use in conjunction with 52002 and donor (designed but not yet ordered).