cDNA Clone BECN1

• Synonyms: ATG6, VPS30, beclin1
• Plasmid: pBABED P U6 BECN1 KI sense
• Parent Plasmid: pBABED P U6
• Expressed: BECN1 KI sense guide
• Genbank: NM_003766.3
• Species: Human

Sequence of Insert

GTCCAACAACAGCACCATGC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52072
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KI guide, use in conjunction with 52083 and donor.