cDNA Clone BECN1

• Synonyms: ATG6, VPS30, beclin1
• Plasmid: pX335 BECN1 KI antisense
• Parent Plasmid: pX335
• Expressed: BECN1 KI antisense guide + Cas9 D10A
• Genbank: NM_003766.3
• Species: Human

Sequence of Insert

GCTTAGACCCTTCCATCCCTG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52083
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KI guide, use in conjunction with 52072 and donor.