cDNA Clone SLC12A2

• Synonyms: BSC, BSC2, NKCC1, PPP1R141
• Plasmid: pBABED P U6 SLC12A2 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: SLC12A2 KO sense guide
• Genbank: ENSG00000064651
• Species: Human

Sequence of Insert

GACGCCGTCAGCCGCTGCGC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52192
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide, use in conjunction with 52200.