cDNA Clone SLC12A2

• Synonyms: BSC, BSC2, NKCC1, PPP1R141
• Plasmid: pBABED P U6 SLC12A2 Nter KI sense
• Parent Plasmid: pBABED P U6
• Expressed: SLC12A2 Nter KI sense guide
• Genbank: ENSG00000064651
• Species: Human

Sequence of Insert

GCGCCGGAGGAGGGCGCCGT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52193
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 52201 and suitable donor e.g. 52358.