cDNA Clone OSR1 (mouse)

• Synonyms: Odd1, Osr, OXSR1
• Plasmid: pX335 OSR1m Nter KI antisense
• Parent Plasmid: pX335
• Expressed: OSR1m Nter KI antisense guide + Cas9 D10A
• Genbank: NM_011859.3
• Species: Mouse

Sequence of Insert

TTGCTGCCCATTTCTGTCGC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52195
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 52187 and suitable donor e.g. 52331.