cDNA Clone CDAN1

• Synonyms: CDA1, CDAIA, DLT, PRO1295
• Plasmid: pX335 CDAN1 ex1 KO antisense
• Parent Plasmid: pX335
• Expressed: CDAN1 ex1 KO antisense guide + Cas9 D10A
• Genbank: ENSG00000140326
• Species: Human

Sequence of Insert

GCGCGCGATCCACCGCACGA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52218
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 1, use in conjunction with 52212.