cDNA Clone STIM1

• Synonyms: D11S4896E, GOK, IMD10, STRMK, TAM, TAM1
• Plasmid: pBABED P U6 STIM1 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: STIM1 KO sense guide
• Genbank: ENSG00000167323
• Species: Human

Sequence of Insert

GAGATGACAGACCGGAGTCAT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52282
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide, use in conjunction with 52301.