cDNA Clone ID1

• Synonyms: AVO3, PIA, hAVO3
• Plasmid: pX335 ID1 Nter KI antisense
• Parent Plasmid: pBABED P U6
• Expressed: ID1 Nter KI antisense guide + cas9 D10A
• Genbank: ENSG00000125968
• Species: Human

Sequence of Insert

GCGGCCTTCAGCGCGCAGCTG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52298
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with both 52279 and a suitable donor.
• Low Temp: No