cDNA Clone SMAD2

• Synonyms: JV18, JV18-1, MADH2, MADR2, hMAD-2, hSMAD2
• Plasmid: pX335 SMAD2 Nter KI antisense
• Parent Plasmid: pBABED P U6
• Expressed: SMAD2 Nter KI antisense guide + cas9 D10A
• Genbank: ENSG00000175387
• Species: Human

Sequence of Insert

GGACGACATGTTCTTACCAA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52300
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR N-terminal KI guide, use in conjunction with 52281 and a suitable donor e.g. 52397.