cDNA Clone ORAI1

• Synonyms: CRACM1, IMD9, ORAT1, TAM2, TMEM142A
• Plasmid: pX335 ORAI1 Cter KI antisense
• Parent Plasmid: pX335
• Expressed: ORAI1 Cter KI antisense guide + Cas9 D10A
• Genbank: ENSG00000276045
• Species: Human

Sequence of Insert

GTCAGGGGGTGGTCCCCTCTG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52304
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR C-terminal KI guide, use in conjunction with 52285 and a suitable donor e.g. 52329.