cDNA Clone FBXO7

• Synonyms: FBX, FBX07, FBX7, PARK15, PKPS
• Plasmid: pX335 FBXO7 ex3 KO antisense
• Parent Plasmid: pX335
• Expressed: FBXO7 ex3 KO antisense guide + Cas9 D10A
• Genbank: ENSG00000100225
• Species: Human

Sequence of Insert

GCAACACTATCAAGGCATCAT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52356
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 3, use in conjunction with 52355.