cDNA Clone WNK3 (mouse)

• Synonyms: Prkwnk3-ps
• Plasmid: pBABED P U6 WNK3m KIKO sense
• Parent Plasmid: pBABED P U6
• Expressed: WNK3m KIKO sense guide
• Genbank: ENSMUSG00000041245
• Species: Mouse

Sequence of Insert

GAAGATTCTGAGAAGCCTGA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52160
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR N-terminal KI guide, use in conjunction with 52165 and a suitable donor e.g. 52365. The guide pair 52160 and 52165 may also be used to KO in the absence of a donor.