cDNA Clone SGK1 (mouse)

• Synonyms: Sgk
• Plasmid: pBABED P U6 mSGK1 ex5 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: mSGK1 ex5 KO sense guide
• Genbank: ENSMUSG00000019970
• Species: Mouse

Sequence of Insert

GAACGCTAACCCCTCTCCTC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52379
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 5, use in conjunction with 52386.