cDNA Clone ORAI3

• Synonyms: TMEM142C
• Plasmid: pBABED P U6 ORAI3 ex1 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: ORAI3 ex1 KO sense guide
• Genbank: ENSG00000175938
• Species: Human

Sequence of Insert

GCTGCAGGCTCGGCCACGTAC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52420
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide, use in conjunction with 52426.