cDNA Clone WNK3

• Synonyms: PRKWNK3
• Plasmid: pX335 WNK3 ex2 KO antisense
• Parent Plasmid: pX335
• Expressed: WNK3 ex2 KO antisense guide
• Genbank: NM_020922.4
• Species: Human

Sequence of Insert

GAATTTCAGGAATCTGCCACT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52435
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Remake of 48799. CRISPR KO guide targeting exon 2. Use in conjunction with DU48773.