cDNA Clone HIF1A

• Synonyms: HIF-1A, HIF-1alpha, HIF1, HIF1-ALPHA, MOP1, PASD8, bHLHe78
• Plasmid: pBABED P U6 HIF1A ex5 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: HIF1A ex5 KO sense guide
• Genbank: ENSG00000100644
• Species: Human

Sequence of Insert

GTGAACATAAAGTCTGCAACA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52509
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 5, use in conjunction with 52508.