cDNA Clone NDP52

• Synonyms: CALCOCO2
• Plasmid: pBABED P U6 NDP52 ex4 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: NDP52 ex4 KO sense guide
• Genbank: ENSG00000136436
• Species: Human

Sequence of Insert

GTTCTGCTATGTGGATGAGGA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52728
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 4, use in conjunction with 52758.