cDNA Clone NDP52

• Synonyms: CALCOCO2
• Plasmid: pX335 NDP52 ex4 KO antisense
• Parent Plasmid: pX335
• Expressed: NDP52 ex4 KO antisense guide + Cas9 D10A
• Genbank: ENSG00000136436
• Species: Human

Sequence of Insert

GTGGTAATACTCATCATCCTT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52758
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 4, use in conjunction with 52728.