cDNA Clone USP22

• Synonyms: USP3L
• Plasmid: pBABED P U6 USP22 ex3 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: USP22 ex3 KO sense guide
• Genbank: ENSG00000124422
• Species: Human

Sequence of Insert

GAGGAGGAGCAGCGAAAAGCT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52784
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 3, use in conjunction with 52799.