cDNA Clone USP49

• Plasmid: pBABED P U6 USP49 ex3 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: USP49 ex3 KO sense guide
• Genbank: ENSG00000164663
• Species: Human

Sequence of Insert

GTGCCACCACCGAGTCCGTG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52785
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 3, use in conjunction with 52800.