cDNA Clone USP22

• Synonyms: USP3L
• Plasmid: pX335 USP22 ex3 KO antisense
• Parent Plasmid: pX335
• Expressed: USP22 ex3 KO antisense guide + Cas9 D10A
• Genbank: ENSG00000124422
• Species: Human

Sequence of Insert

GCTTTGTCATAGATGTAGTCC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52799
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 3, use in conjunction with 52784.