cDNA Clone RFWD3

• Synonyms: RNF201
• Plasmid: pX335 RFWD3 Nter KI antisense B
• Parent Plasmid: pX335
• Expressed: RFWD3 Nter KI antisense guide B + Cas9n
• Genbank: ENSG00000168411
• Species: Human

Sequence of Insert

GCCTCCAGCCAGCTCCTGCTG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54009
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KI guide targeting exon 1, use in conjunction with 52999 and a suitable donor e.g. 54027.