cDNA Clone FANCD2

• Synonyms: FA-D2, FA4, FACD, FAD, FAD2, FANCD
• Plasmid: pBABED P U6 FANCD2 Nter KI sense
• Parent Plasmid: pBABED P U6
• Expressed: FANCD2 Nter KI sense guide
• Genbank: ENSG00000144554
• Species: Human

Sequence of Insert

GTTACTTCCTAGAGCAAAATC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54034
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 54006 and a suitable donor e.g. 52994. Grow at or below 30ºC
• Low Temp: Yes