cDNA Clone USP22

• Synonyms: USP3L
• Plasmid: pCMV Cas9n 2A Puro USP22 Cter KI B sv
• Parent Plasmid: pCMV Cas9 2A Puro sv
• Expressed: USP22 Cter KI sense guide B; antisense guide B; Cas9n; Puro
• Genbank: ENSG00000124422
• Species: Human

Sequence of Insert

sense: GATAAGGCTACTCGTATTCC
antisense: GCAGCTGGTCAGAAAAACAA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54154
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR single vector expressing both guides for introducing a KI at the C-terminus, needs to be co-transfected with an appropriate donor. This vector also expresses Cas9n and a separate Puro marker from a CMV promoter. The reduction of the number of plasmids coupled with Puro for enrichment should allow targeting in difficult to transfect cell-types, all resistant cells should contain the necessary components for CRISPR targeting.