cDNA Clone ERCC5

• Synonyms: COFS3-201, ERCM2, UVDR, XPG, XPGC
• Plasmid: pBABED P U6 ERCC5 ex11 sense
• Parent Plasmid: pBABED P U6
• Expressed: ERCC5 ex11 sense guide
• Genbank: ENSG00000134899
• Species: Human

Sequence of Insert

GGATGTAGGGAATGCCGAAC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54227
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 11.