cDNA Clone TRIM49

• Synonyms: RNF18A, TRIM49L2
• Plasmid: pX335 TRIM49 ex3 KO antisense
• Parent Plasmid: pX335
• Expressed: TRIM49 ex3 KO antisense + Cas9n
• Genbank: ENSG00000168930
• Species: Human

Sequence of Insert

GACCCGGTCACCATAGACTGT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54305
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR ex3 KO guide, use in conjunction with 54298.