cDNA Clone TRIM49

• Synonyms: RNF18A, TRIM49L2
• Plasmid: pCMV Cas9hf1 Puro TRIM49 ex3 KO sense
• Parent Plasmid: pCMV Cas9hf1 Puro U6
• Expressed: TRIM49 ex3 KO sense + Cas9hf1 + Puro
• Genbank: ENSG00000168930
• Species: Human

Sequence of Insert

GCTATGAAGTAGTTCATGCAC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54311
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR single vector system targeting exon 3. Expresses all necessary components including High Fidelity Cas9 and Puro for selection.