cDNA Clone RFWD3

• Synonyms: RNF201
• Plasmid: pX335 RFWD3 ex3 KO antisense
• Parent Plasmid: pX335
• Expressed: RFWD3 ex3 KO antisense guide + Cas9n
• Genbank: ENSG00000168411
• Species: Human

Sequence of Insert

GTCCTGTATCTGAAGAGTTGC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54649
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide targeting exon 3, use in conjunction with 54647.