cDNA Clone MAPK7 (mouse)

• Synonyms: Erk5, BMK
• Plasmid: pBabeD pU6 MAPK7 (mouse) Nter KI Sense
• Parent Plasmid: pBabeD pU6
• Expressed: MAPK7 (mouse) N-Term Nter KI Sense Guide
• Genbank: ENSMUSG00000001034
• Species: Mouse

Sequence of Insert

GCCTCTCAGTTCCGCCTCTGT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54741
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 54743 and a suitable donor.