cDNA Clone FBXO16

• Plasmid: pSuperior neo GFP FBXO16 shRNA scrambled
• Parent Plasmid: pSuperior neo GFP
• Expressed: GFP, FBXO16-shRNA scrambled
• Genbank: NM_172366.3
• Tag: GFP
• Species: Human

Sequence of Insert

AGATGCGATCGTAATCACCCGAGTGCTCGAGCACTCGGGTGATTACGATCGCAGCTT

• Vector Type: Mammalian
• Antibiotic: Amp
• Full Snapgene Map: pSuperior neo GFP FBXO16 shRNA scrambled78.6 KBSnapgene files can be opened using software available here: www.snapgene.com
• DU Number: DU63972
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Low Temp: No