cDNA Clone PRKAA2

• Synonyms: AMPK, AMPK2, AMPKa2, PRKAA
• Plasmid: pX459 PRKAA2 ex4 KO Sense G3
• Parent Plasmid: pX459
• Expressed: PRKAA2 ex4 G3 + spCas9 + puro
• Genbank: ENSG00000162409
• Species: Human

Sequence of Insert

GACAGGACATTCTCTGGTTTC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU64961
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide. Single vector system expressing spCas9 and puro for selection. Test all 3 individually and then use the optimal guide in combination with the optimal PRKAA1 guide to obtain the double KO.
• Low Temp: No