cDNA Clone STK11

• Synonyms: PJS, LKB1, hLKB1
• Plasmid: pSUPER.retro.puro-HLKB1.1
• Parent Plasmid: pSuper retro puro
• Genbank: NM_000455.4

Sequence of Insert

cgaagagaagcagaaaatgt

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU19487
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Targets 1472-1491 bp of the reference sequence (357-376 bp of cds). The target sequence is shown as insert