cDNA Clone SGK3

• Synonyms: CISK, SGKL
• Plasmid: pBABED P U6 SGK3 Cter gRNA
• Parent Plasmid: pBabeD puro + U6 poly
• Expressed: SGK3 Cter gRNA
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GAGGCAGATGATGCATTCGT(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48216
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses SGK3 guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets last coding exon (exon 17).