cDNA Clone PDAH1

• Plasmid: pU6D PDHA1 BsmBI KO guide C
• Parent Plasmid: pU6D gRNA
• Expressed: PDHA1 BsmBI KO guide C
• Genbank: ENSG00000131828
• Species: Human

Sequence of Insert

GCCACTGCCTGTGCTTCATG(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48558
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses PDHA1 BsmBI KO guide RNA C, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Target site situated on the antisense strand of exon 1 and guide designed to KO PDAH1 by introducing an Indel via CRISPR. To be screened for by PCR and BsmBI digestion, loss of the site shall indicate a deletion event and potential frameshift.