cDNA Clone SPAK

• Synonyms: STK39, DCHT, PASK
• Plasmid: pU6D SPAK PspFI KO Guide C
• Parent Plasmid: pU6D gRNA
• Expressed: SPAK PspFI KO Guide C
• Genbank: NP_037365.2
• Species: Human

Sequence of Insert

GCACGTCCAGCTTCCCCAGC(AGG)

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48608
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in first common coding exon of SPAK, indel formation may lead to the deletion of a PspFI site allowing RFLP screening. Guide sequence shown as sequence of insert with PAM in brackets.