cDNA Clone SGK3

• Synonyms: CISK, SGKL, SGK2
• Plasmid: pU6D shuttle SGK3 Nter NcoI KO antisense
• Parent Plasmid: pU6D shuttle
• Expressed: SGK3 Nter NcoI KO antisense
• Genbank: ENSG00000104205
• Species: Human

Sequence of Insert

GCAGCTTTCCTTGTAGTCCA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48711
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets antisense strand in first coding exon, may be used in conjunction with 48712 and Cas9 D10A where possible to improve specificity. Western blotting should be preferentially used to screen for KOs as there is a good antibody. The insert may be excised and shuttled to destination lentiviral vectors as necessary. Note that use of these guides is likely to KO only the longer variants of SGK3.