cDNA Clone SGK3

• Synonyms: cas9
• Plasmid: pLVX TIGHT D10A SGK3 Nter sense
• Parent Plasmid: pLVX TIGHT D10A
• Expressed: SGK3 Nter sense guide

Sequence of Insert

GAACACAGAGAGAAAAAGAAG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48746
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Lentiviral vector for use in CRISPR procedures. Expresses an in-house synthesised Cas9 D10A nickase mutant under the control of the tet-inducible promoter TRE3GS. Targets sense strand in first coding exon for N-terminal tagging, to be used to infect target cells which have already integrated the antisense guide and donor (DU48749). Following infection Cas9 D10A expression should be switched on via Dox induction to proceed with CRISPR modification. FACs sorting should be used to isolate GFP-expressing clones. Guide sequence shown as sequence of insert.