cDNA Clone SGK3

• Synonyms: cas9
• Plasmid: pLVX TIGHT D10A SGK3 common sense
• Parent Plasmid: pLVX TIGHT D10A
• Expressed: SGK3 common sense

Sequence of Insert

GTCAGATCCATCTGAAGATG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48747
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Lentiviral vector for use in CRISPR procedures. Expresses an in-house synthesised Cas9 D10A nickase mutant under the control of the tet-inducible promoter TRE3GS. Targets sense strand in first common exon (exon 6), to be used to infect target cells which have already integrated the antisense guide (DU48731). Following infection Cas9 D10A expression should be switched on via Dox induction to proceed with CRISPR modification. Western blotting should be used to isolate to identify knockdown and eventually full knock-out clones. Guide sequence shown as sequence of insert.