cDNA Clone RAB1A

• Synonyms: RAB1, YPT1
• Plasmid: pX335 RAB1A KO antisense
• Parent Plasmid: pX335
• Expressed: RAB1A KO antisense guide + Cas9 D10A
• Genbank: NM_004161.4
• Species: Human

Sequence of Insert

GTATATGTATCATCCTGAAG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48945
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets antisense strand of exon 1, designed to KO RAB1A when co-transfected with sense guide 48931. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.