cDNA Clone SPG15

• Synonyms: ZFYVE26, FYVE-CENT
• Plasmid: pX335 SPG15 Nter KI antisense
• Parent Plasmid: pBABED P U6
• Expressed: SPG15 Nter KI antisense guide + Cas9 D10A
• Genbank: ENSG00000072121
• Species: Human

Sequence of Insert

GCAGCTTCCTCTTTTCCAAA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52344
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 52338 and a suitable donor.